ID: 1066541007

View in Genome Browser
Species Human (GRCh38)
Location 10:36446948-36446970
Sequence AGCGTCACCTCTGCTCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066541007_1066541009 -10 Left 1066541007 10:36446948-36446970 CCCAGGCGAGCAGAGGTGACGCT No data
Right 1066541009 10:36446961-36446983 AGGTGACGCTGCCTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066541007 Original CRISPR AGCGTCACCTCTGCTCGCCT GGG (reversed) Intergenic
No off target data available for this crispr