ID: 1066550280

View in Genome Browser
Species Human (GRCh38)
Location 10:36548271-36548293
Sequence GAGTTGAGCAGGACAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066550280_1066550292 25 Left 1066550280 10:36548271-36548293 CCCTCTTTTGTCCTGCTCAACTC No data
Right 1066550292 10:36548319-36548341 TTATGGCATCATTTCGGGCTTGG No data
1066550280_1066550290 19 Left 1066550280 10:36548271-36548293 CCCTCTTTTGTCCTGCTCAACTC No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550280_1066550288 8 Left 1066550280 10:36548271-36548293 CCCTCTTTTGTCCTGCTCAACTC No data
Right 1066550288 10:36548302-36548324 CCTTAGAGCCTTTGTTCTTATGG No data
1066550280_1066550291 20 Left 1066550280 10:36548271-36548293 CCCTCTTTTGTCCTGCTCAACTC No data
Right 1066550291 10:36548314-36548336 TGTTCTTATGGCATCATTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066550280 Original CRISPR GAGTTGAGCAGGACAAAAGA GGG (reversed) Intergenic
No off target data available for this crispr