ID: 1066550281

View in Genome Browser
Species Human (GRCh38)
Location 10:36548272-36548294
Sequence GGAGTTGAGCAGGACAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066550281_1066550291 19 Left 1066550281 10:36548272-36548294 CCTCTTTTGTCCTGCTCAACTCC No data
Right 1066550291 10:36548314-36548336 TGTTCTTATGGCATCATTTCGGG No data
1066550281_1066550292 24 Left 1066550281 10:36548272-36548294 CCTCTTTTGTCCTGCTCAACTCC No data
Right 1066550292 10:36548319-36548341 TTATGGCATCATTTCGGGCTTGG No data
1066550281_1066550288 7 Left 1066550281 10:36548272-36548294 CCTCTTTTGTCCTGCTCAACTCC No data
Right 1066550288 10:36548302-36548324 CCTTAGAGCCTTTGTTCTTATGG No data
1066550281_1066550290 18 Left 1066550281 10:36548272-36548294 CCTCTTTTGTCCTGCTCAACTCC No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066550281 Original CRISPR GGAGTTGAGCAGGACAAAAG AGG (reversed) Intergenic
No off target data available for this crispr