ID: 1066550288

View in Genome Browser
Species Human (GRCh38)
Location 10:36548302-36548324
Sequence CCTTAGAGCCTTTGTTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066550282_1066550288 -3 Left 1066550282 10:36548282-36548304 CCTGCTCAACTCCCTCCCTTCCT No data
Right 1066550288 10:36548302-36548324 CCTTAGAGCCTTTGTTCTTATGG No data
1066550278_1066550288 16 Left 1066550278 10:36548263-36548285 CCCACAAACCCTCTTTTGTCCTG No data
Right 1066550288 10:36548302-36548324 CCTTAGAGCCTTTGTTCTTATGG No data
1066550281_1066550288 7 Left 1066550281 10:36548272-36548294 CCTCTTTTGTCCTGCTCAACTCC No data
Right 1066550288 10:36548302-36548324 CCTTAGAGCCTTTGTTCTTATGG No data
1066550279_1066550288 15 Left 1066550279 10:36548264-36548286 CCACAAACCCTCTTTTGTCCTGC No data
Right 1066550288 10:36548302-36548324 CCTTAGAGCCTTTGTTCTTATGG No data
1066550280_1066550288 8 Left 1066550280 10:36548271-36548293 CCCTCTTTTGTCCTGCTCAACTC No data
Right 1066550288 10:36548302-36548324 CCTTAGAGCCTTTGTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066550288 Original CRISPR CCTTAGAGCCTTTGTTCTTA TGG Intergenic
No off target data available for this crispr