ID: 1066550290

View in Genome Browser
Species Human (GRCh38)
Location 10:36548313-36548335
Sequence TTGTTCTTATGGCATCATTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066550285_1066550290 -7 Left 1066550285 10:36548297-36548319 CCCTTCCTTAGAGCCTTTGTTCT No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550283_1066550290 -3 Left 1066550283 10:36548293-36548315 CCCTCCCTTCCTTAGAGCCTTTG No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550278_1066550290 27 Left 1066550278 10:36548263-36548285 CCCACAAACCCTCTTTTGTCCTG No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550282_1066550290 8 Left 1066550282 10:36548282-36548304 CCTGCTCAACTCCCTCCCTTCCT No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550286_1066550290 -8 Left 1066550286 10:36548298-36548320 CCTTCCTTAGAGCCTTTGTTCTT No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550279_1066550290 26 Left 1066550279 10:36548264-36548286 CCACAAACCCTCTTTTGTCCTGC No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550280_1066550290 19 Left 1066550280 10:36548271-36548293 CCCTCTTTTGTCCTGCTCAACTC No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550281_1066550290 18 Left 1066550281 10:36548272-36548294 CCTCTTTTGTCCTGCTCAACTCC No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data
1066550284_1066550290 -4 Left 1066550284 10:36548294-36548316 CCTCCCTTCCTTAGAGCCTTTGT No data
Right 1066550290 10:36548313-36548335 TTGTTCTTATGGCATCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066550290 Original CRISPR TTGTTCTTATGGCATCATTT CGG Intergenic
No off target data available for this crispr