ID: 1066550710

View in Genome Browser
Species Human (GRCh38)
Location 10:36553263-36553285
Sequence CAGTGTGATCAGAGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066550706_1066550710 5 Left 1066550706 10:36553235-36553257 CCTGAAATGAACTAGCAAAAAAT No data
Right 1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066550710 Original CRISPR CAGTGTGATCAGAGGCAGGG TGG Intergenic
No off target data available for this crispr