ID: 1066551623

View in Genome Browser
Species Human (GRCh38)
Location 10:36564886-36564908
Sequence AGCTACAACTTCCATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066551623_1066551627 3 Left 1066551623 10:36564886-36564908 CCCACCAAATGGAAGTTGTAGCT No data
Right 1066551627 10:36564912-36564934 ACGTGTCCTCTGAGAGAGGCTGG No data
1066551623_1066551626 -1 Left 1066551623 10:36564886-36564908 CCCACCAAATGGAAGTTGTAGCT No data
Right 1066551626 10:36564908-36564930 TGAAACGTGTCCTCTGAGAGAGG No data
1066551623_1066551629 24 Left 1066551623 10:36564886-36564908 CCCACCAAATGGAAGTTGTAGCT No data
Right 1066551629 10:36564933-36564955 GGCGCTCTCTCCGCCCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066551623 Original CRISPR AGCTACAACTTCCATTTGGT GGG (reversed) Intergenic
No off target data available for this crispr