ID: 1066551628

View in Genome Browser
Species Human (GRCh38)
Location 10:36564918-36564940
Sequence AGAGCGCCAGCCTCTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066551628_1066551629 -8 Left 1066551628 10:36564918-36564940 CCTCTGAGAGAGGCTGGCGCTCT No data
Right 1066551629 10:36564933-36564955 GGCGCTCTCTCCGCCCGTCCTGG No data
1066551628_1066551635 19 Left 1066551628 10:36564918-36564940 CCTCTGAGAGAGGCTGGCGCTCT No data
Right 1066551635 10:36564960-36564982 CCCTTCACCATCTGCACTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066551628 Original CRISPR AGAGCGCCAGCCTCTCTCAG AGG (reversed) Intergenic