ID: 1066551629

View in Genome Browser
Species Human (GRCh38)
Location 10:36564933-36564955
Sequence GGCGCTCTCTCCGCCCGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066551624_1066551629 23 Left 1066551624 10:36564887-36564909 CCACCAAATGGAAGTTGTAGCTG No data
Right 1066551629 10:36564933-36564955 GGCGCTCTCTCCGCCCGTCCTGG No data
1066551625_1066551629 20 Left 1066551625 10:36564890-36564912 CCAAATGGAAGTTGTAGCTGAAA No data
Right 1066551629 10:36564933-36564955 GGCGCTCTCTCCGCCCGTCCTGG No data
1066551623_1066551629 24 Left 1066551623 10:36564886-36564908 CCCACCAAATGGAAGTTGTAGCT No data
Right 1066551629 10:36564933-36564955 GGCGCTCTCTCCGCCCGTCCTGG No data
1066551628_1066551629 -8 Left 1066551628 10:36564918-36564940 CCTCTGAGAGAGGCTGGCGCTCT No data
Right 1066551629 10:36564933-36564955 GGCGCTCTCTCCGCCCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066551629 Original CRISPR GGCGCTCTCTCCGCCCGTCC TGG Intergenic
No off target data available for this crispr