ID: 1066551635

View in Genome Browser
Species Human (GRCh38)
Location 10:36564960-36564982
Sequence CCCTTCACCATCTGCACTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066551630_1066551635 -6 Left 1066551630 10:36564943-36564965 CCGCCCGTCCTGGTACACCCTTC No data
Right 1066551635 10:36564960-36564982 CCCTTCACCATCTGCACTTACGG No data
1066551628_1066551635 19 Left 1066551628 10:36564918-36564940 CCTCTGAGAGAGGCTGGCGCTCT No data
Right 1066551635 10:36564960-36564982 CCCTTCACCATCTGCACTTACGG No data
1066551632_1066551635 -10 Left 1066551632 10:36564947-36564969 CCGTCCTGGTACACCCTTCACCA No data
Right 1066551635 10:36564960-36564982 CCCTTCACCATCTGCACTTACGG No data
1066551631_1066551635 -9 Left 1066551631 10:36564946-36564968 CCCGTCCTGGTACACCCTTCACC No data
Right 1066551635 10:36564960-36564982 CCCTTCACCATCTGCACTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066551635 Original CRISPR CCCTTCACCATCTGCACTTA CGG Intergenic
No off target data available for this crispr