ID: 1066562272

View in Genome Browser
Species Human (GRCh38)
Location 10:36683054-36683076
Sequence TGTTCTATAAGATCATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066562272_1066562276 28 Left 1066562272 10:36683054-36683076 CCTGTAGATGATCTTATAGAACA No data
Right 1066562276 10:36683105-36683127 CAAAGCTTTTATAAAAATGTAGG No data
1066562272_1066562277 29 Left 1066562272 10:36683054-36683076 CCTGTAGATGATCTTATAGAACA No data
Right 1066562277 10:36683106-36683128 AAAGCTTTTATAAAAATGTAGGG No data
1066562272_1066562275 2 Left 1066562272 10:36683054-36683076 CCTGTAGATGATCTTATAGAACA No data
Right 1066562275 10:36683079-36683101 GGTGTACTTCATTTTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066562272 Original CRISPR TGTTCTATAAGATCATCTAC AGG (reversed) Intergenic
No off target data available for this crispr