ID: 1066563140

View in Genome Browser
Species Human (GRCh38)
Location 10:36691927-36691949
Sequence TGAGTCAGAGTAGGAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563140_1066563147 25 Left 1066563140 10:36691927-36691949 CCACTTTTTCCTACTCTGACTCA No data
Right 1066563147 10:36691975-36691997 CTTCCCTTTCTCCATCCTCCTGG No data
1066563140_1066563149 28 Left 1066563140 10:36691927-36691949 CCACTTTTTCCTACTCTGACTCA No data
Right 1066563149 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563140 Original CRISPR TGAGTCAGAGTAGGAAAAAG TGG (reversed) Intergenic