ID: 1066563142

View in Genome Browser
Species Human (GRCh38)
Location 10:36691964-36691986
Sequence GAGAAAGGGAAGGGCACGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563142_1066563155 6 Left 1066563142 10:36691964-36691986 CCACCCGTGCCCTTCCCTTTCTC No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563142_1066563153 5 Left 1066563142 10:36691964-36691986 CCACCCGTGCCCTTCCCTTTCTC No data
Right 1066563153 10:36691992-36692014 TCCTGGTGGTCCCCAGTCGCAGG No data
1066563142_1066563149 -9 Left 1066563142 10:36691964-36691986 CCACCCGTGCCCTTCCCTTTCTC No data
Right 1066563149 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563142 Original CRISPR GAGAAAGGGAAGGGCACGGG TGG (reversed) Intergenic