ID: 1066563143

View in Genome Browser
Species Human (GRCh38)
Location 10:36691967-36691989
Sequence ATGGAGAAAGGGAAGGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563143_1066563153 2 Left 1066563143 10:36691967-36691989 CCCGTGCCCTTCCCTTTCTCCAT No data
Right 1066563153 10:36691992-36692014 TCCTGGTGGTCCCCAGTCGCAGG No data
1066563143_1066563155 3 Left 1066563143 10:36691967-36691989 CCCGTGCCCTTCCCTTTCTCCAT No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563143 Original CRISPR ATGGAGAAAGGGAAGGGCAC GGG (reversed) Intergenic