ID: 1066563144

View in Genome Browser
Species Human (GRCh38)
Location 10:36691968-36691990
Sequence GATGGAGAAAGGGAAGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563144_1066563155 2 Left 1066563144 10:36691968-36691990 CCGTGCCCTTCCCTTTCTCCATC No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563144_1066563153 1 Left 1066563144 10:36691968-36691990 CCGTGCCCTTCCCTTTCTCCATC No data
Right 1066563153 10:36691992-36692014 TCCTGGTGGTCCCCAGTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563144 Original CRISPR GATGGAGAAAGGGAAGGGCA CGG (reversed) Intergenic