ID: 1066563145

View in Genome Browser
Species Human (GRCh38)
Location 10:36691973-36691995
Sequence AGGAGGATGGAGAAAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563145_1066563159 29 Left 1066563145 10:36691973-36691995 CCCTTCCCTTTCTCCATCCTCCT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563145_1066563155 -3 Left 1066563145 10:36691973-36691995 CCCTTCCCTTTCTCCATCCTCCT No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563145_1066563153 -4 Left 1066563145 10:36691973-36691995 CCCTTCCCTTTCTCCATCCTCCT No data
Right 1066563153 10:36691992-36692014 TCCTGGTGGTCCCCAGTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563145 Original CRISPR AGGAGGATGGAGAAAGGGAA GGG (reversed) Intergenic