ID: 1066563148

View in Genome Browser
Species Human (GRCh38)
Location 10:36691978-36692000
Sequence CCACCAGGAGGATGGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563148_1066563153 -9 Left 1066563148 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data
Right 1066563153 10:36691992-36692014 TCCTGGTGGTCCCCAGTCGCAGG No data
1066563148_1066563159 24 Left 1066563148 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563148_1066563155 -8 Left 1066563148 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563148 Original CRISPR CCACCAGGAGGATGGAGAAA GGG (reversed) Intergenic