ID: 1066563149

View in Genome Browser
Species Human (GRCh38)
Location 10:36691978-36692000
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563141_1066563149 19 Left 1066563141 10:36691936-36691958 CCTACTCTGACTCAATACTCAGT No data
Right 1066563149 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data
1066563140_1066563149 28 Left 1066563140 10:36691927-36691949 CCACTTTTTCCTACTCTGACTCA No data
Right 1066563149 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data
1066563142_1066563149 -9 Left 1066563142 10:36691964-36691986 CCACCCGTGCCCTTCCCTTTCTC No data
Right 1066563149 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563149 Original CRISPR CCCTTTCTCCATCCTCCTGG TGG Intergenic