ID: 1066563150

View in Genome Browser
Species Human (GRCh38)
Location 10:36691979-36692001
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563150_1066563155 -9 Left 1066563150 10:36691979-36692001 CCTTTCTCCATCCTCCTGGTGGT No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563150_1066563153 -10 Left 1066563150 10:36691979-36692001 CCTTTCTCCATCCTCCTGGTGGT No data
Right 1066563153 10:36691992-36692014 TCCTGGTGGTCCCCAGTCGCAGG No data
1066563150_1066563159 23 Left 1066563150 10:36691979-36692001 CCTTTCTCCATCCTCCTGGTGGT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563150 Original CRISPR ACCACCAGGAGGATGGAGAA AGG (reversed) Intergenic