ID: 1066563152

View in Genome Browser
Species Human (GRCh38)
Location 10:36691990-36692012
Sequence TGCGACTGGGGACCACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563152_1066563159 12 Left 1066563152 10:36691990-36692012 CCTCCTGGTGGTCCCCAGTCGCA No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563152 Original CRISPR TGCGACTGGGGACCACCAGG AGG (reversed) Intergenic