ID: 1066563154

View in Genome Browser
Species Human (GRCh38)
Location 10:36691993-36692015
Sequence CCCTGCGACTGGGGACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563154_1066563159 9 Left 1066563154 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563154 Original CRISPR CCCTGCGACTGGGGACCACC AGG (reversed) Intergenic