ID: 1066563155

View in Genome Browser
Species Human (GRCh38)
Location 10:36691993-36692015
Sequence CCTGGTGGTCCCCAGTCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563150_1066563155 -9 Left 1066563150 10:36691979-36692001 CCTTTCTCCATCCTCCTGGTGGT No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563143_1066563155 3 Left 1066563143 10:36691967-36691989 CCCGTGCCCTTCCCTTTCTCCAT No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563148_1066563155 -8 Left 1066563148 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563146_1066563155 -4 Left 1066563146 10:36691974-36691996 CCTTCCCTTTCTCCATCCTCCTG No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563142_1066563155 6 Left 1066563142 10:36691964-36691986 CCACCCGTGCCCTTCCCTTTCTC No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563145_1066563155 -3 Left 1066563145 10:36691973-36691995 CCCTTCCCTTTCTCCATCCTCCT No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
1066563144_1066563155 2 Left 1066563144 10:36691968-36691990 CCGTGCCCTTCCCTTTCTCCATC No data
Right 1066563155 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563155 Original CRISPR CCTGGTGGTCCCCAGTCGCA GGG Intergenic