ID: 1066563156

View in Genome Browser
Species Human (GRCh38)
Location 10:36692002-36692024
Sequence TATTACAGACCCTGCGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563156_1066563159 0 Left 1066563156 10:36692002-36692024 CCCCAGTCGCAGGGTCTGTAATA No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563156_1066563162 29 Left 1066563156 10:36692002-36692024 CCCCAGTCGCAGGGTCTGTAATA No data
Right 1066563162 10:36692054-36692076 CCACATCATGCTGATCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563156 Original CRISPR TATTACAGACCCTGCGACTG GGG (reversed) Intergenic