ID: 1066563158 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:36692004-36692026 |
| Sequence | AATATTACAGACCCTGCGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1066563158_1066563162 | 27 | Left | 1066563158 | 10:36692004-36692026 | CCAGTCGCAGGGTCTGTAATATT | No data | ||
| Right | 1066563162 | 10:36692054-36692076 | CCACATCATGCTGATCCACCTGG | No data | ||||
| 1066563158_1066563159 | -2 | Left | 1066563158 | 10:36692004-36692026 | CCAGTCGCAGGGTCTGTAATATT | No data | ||
| Right | 1066563159 | 10:36692025-36692047 | TTGCACTAGCCTTTTACTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1066563158 | Original CRISPR | AATATTACAGACCCTGCGAC TGG (reversed) | Intergenic | ||