ID: 1066563158

View in Genome Browser
Species Human (GRCh38)
Location 10:36692004-36692026
Sequence AATATTACAGACCCTGCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563158_1066563162 27 Left 1066563158 10:36692004-36692026 CCAGTCGCAGGGTCTGTAATATT No data
Right 1066563162 10:36692054-36692076 CCACATCATGCTGATCCACCTGG No data
1066563158_1066563159 -2 Left 1066563158 10:36692004-36692026 CCAGTCGCAGGGTCTGTAATATT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563158 Original CRISPR AATATTACAGACCCTGCGAC TGG (reversed) Intergenic