ID: 1066563159

View in Genome Browser
Species Human (GRCh38)
Location 10:36692025-36692047
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563151_1066563159 16 Left 1066563151 10:36691986-36692008 CCATCCTCCTGGTGGTCCCCAGT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563157_1066563159 -1 Left 1066563157 10:36692003-36692025 CCCAGTCGCAGGGTCTGTAATAT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563148_1066563159 24 Left 1066563148 10:36691978-36692000 CCCTTTCTCCATCCTCCTGGTGG No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563154_1066563159 9 Left 1066563154 10:36691993-36692015 CCTGGTGGTCCCCAGTCGCAGGG No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563152_1066563159 12 Left 1066563152 10:36691990-36692012 CCTCCTGGTGGTCCCCAGTCGCA No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563146_1066563159 28 Left 1066563146 10:36691974-36691996 CCTTCCCTTTCTCCATCCTCCTG No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563158_1066563159 -2 Left 1066563158 10:36692004-36692026 CCAGTCGCAGGGTCTGTAATATT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563156_1066563159 0 Left 1066563156 10:36692002-36692024 CCCCAGTCGCAGGGTCTGTAATA No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563150_1066563159 23 Left 1066563150 10:36691979-36692001 CCTTTCTCCATCCTCCTGGTGGT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data
1066563145_1066563159 29 Left 1066563145 10:36691973-36691995 CCCTTCCCTTTCTCCATCCTCCT No data
Right 1066563159 10:36692025-36692047 TTGCACTAGCCTTTTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563159 Original CRISPR TTGCACTAGCCTTTTACTTG AGG Intergenic