ID: 1066563162

View in Genome Browser
Species Human (GRCh38)
Location 10:36692054-36692076
Sequence CCACATCATGCTGATCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066563156_1066563162 29 Left 1066563156 10:36692002-36692024 CCCCAGTCGCAGGGTCTGTAATA No data
Right 1066563162 10:36692054-36692076 CCACATCATGCTGATCCACCTGG No data
1066563157_1066563162 28 Left 1066563157 10:36692003-36692025 CCCAGTCGCAGGGTCTGTAATAT No data
Right 1066563162 10:36692054-36692076 CCACATCATGCTGATCCACCTGG No data
1066563160_1066563162 -3 Left 1066563160 10:36692034-36692056 CCTTTTACTTGAGGCAATCTCCA No data
Right 1066563162 10:36692054-36692076 CCACATCATGCTGATCCACCTGG No data
1066563158_1066563162 27 Left 1066563158 10:36692004-36692026 CCAGTCGCAGGGTCTGTAATATT No data
Right 1066563162 10:36692054-36692076 CCACATCATGCTGATCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066563162 Original CRISPR CCACATCATGCTGATCCACC TGG Intergenic