ID: 1066584012

View in Genome Browser
Species Human (GRCh38)
Location 10:36912387-36912409
Sequence CTCTCGGCAGAAACTCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066584012_1066584017 12 Left 1066584012 10:36912387-36912409 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1066584017 10:36912422-36912444 TCTGATGGGCTTCCCTTTGTGGG 0: 4645
1: 4506
2: 1938
3: 878
4: 1128
1066584012_1066584015 -2 Left 1066584012 10:36912387-36912409 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1066584015 10:36912408-36912430 AGATCAGCTGTTAGTCTGATGGG 0: 1312
1: 4659
2: 3111
3: 2328
4: 1903
1066584012_1066584014 -3 Left 1066584012 10:36912387-36912409 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1066584014 10:36912407-36912429 GAGATCAGCTGTTAGTCTGATGG 0: 1342
1: 4586
2: 3146
3: 1798
4: 1323
1066584012_1066584016 11 Left 1066584012 10:36912387-36912409 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1066584016 10:36912421-36912443 GTCTGATGGGCTTCCCTTTGTGG 0: 5864
1: 2938
2: 903
3: 329
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066584012 Original CRISPR CTCTCGGCAGAAACTCTACA AGG (reversed) Intergenic
No off target data available for this crispr