ID: 1066587538

View in Genome Browser
Species Human (GRCh38)
Location 10:36952905-36952927
Sequence CTGTATATGGAGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066587532_1066587538 3 Left 1066587532 10:36952879-36952901 CCCTACATAAATACATGATTATC No data
Right 1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG No data
1066587533_1066587538 2 Left 1066587533 10:36952880-36952902 CCTACATAAATACATGATTATCT No data
Right 1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066587538 Original CRISPR CTGTATATGGAGAAGGAGGT GGG Intergenic
No off target data available for this crispr