ID: 1066590639

View in Genome Browser
Species Human (GRCh38)
Location 10:36989894-36989916
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066590635_1066590639 19 Left 1066590635 10:36989852-36989874 CCATTTTTTTTTTCATAATATAT No data
Right 1066590639 10:36989894-36989916 ATGTGGACATAGTTTAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066590639 Original CRISPR ATGTGGACATAGTTTAAGAT GGG Intergenic
No off target data available for this crispr