ID: 1066593243

View in Genome Browser
Species Human (GRCh38)
Location 10:37019260-37019282
Sequence CCTAGCAGGTCCCACCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066593238_1066593243 -7 Left 1066593238 10:37019244-37019266 CCAAAGTTATACCTGTCCTAGCA No data
Right 1066593243 10:37019260-37019282 CCTAGCAGGTCCCACCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066593243 Original CRISPR CCTAGCAGGTCCCACCTGAA GGG Intergenic
No off target data available for this crispr