ID: 1066593788

View in Genome Browser
Species Human (GRCh38)
Location 10:37025813-37025835
Sequence AGTTGGATTTTGAACCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066593785_1066593788 -3 Left 1066593785 10:37025793-37025815 CCTTGATAGGCCTGGAGTTGAGT No data
Right 1066593788 10:37025813-37025835 AGTTGGATTTTGAACCCAGATGG No data
1066593783_1066593788 5 Left 1066593783 10:37025785-37025807 CCATCTGACCTTGATAGGCCTGG No data
Right 1066593788 10:37025813-37025835 AGTTGGATTTTGAACCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066593788 Original CRISPR AGTTGGATTTTGAACCCAGA TGG Intergenic
No off target data available for this crispr