ID: 1066596726

View in Genome Browser
Species Human (GRCh38)
Location 10:37059177-37059199
Sequence AGTTCAATTGGAAGACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066596720_1066596726 4 Left 1066596720 10:37059150-37059172 CCTCAGCTCTACCCTCCCAGAGC No data
Right 1066596726 10:37059177-37059199 AGTTCAATTGGAAGACAATCAGG No data
1066596721_1066596726 -7 Left 1066596721 10:37059161-37059183 CCCTCCCAGAGCTCATAGTTCAA No data
Right 1066596726 10:37059177-37059199 AGTTCAATTGGAAGACAATCAGG No data
1066596722_1066596726 -8 Left 1066596722 10:37059162-37059184 CCTCCCAGAGCTCATAGTTCAAT No data
Right 1066596726 10:37059177-37059199 AGTTCAATTGGAAGACAATCAGG No data
1066596719_1066596726 9 Left 1066596719 10:37059145-37059167 CCAAACCTCAGCTCTACCCTCCC No data
Right 1066596726 10:37059177-37059199 AGTTCAATTGGAAGACAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066596726 Original CRISPR AGTTCAATTGGAAGACAATC AGG Intergenic
No off target data available for this crispr