ID: 1066597064

View in Genome Browser
Species Human (GRCh38)
Location 10:37062512-37062534
Sequence CGCCCACCTGGAACTCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066597064_1066597071 17 Left 1066597064 10:37062512-37062534 CCAGCGGGAGTTCCAGGTGGGCG No data
Right 1066597071 10:37062552-37062574 CTGCATTGATTTAATAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066597064 Original CRISPR CGCCCACCTGGAACTCCCGC TGG (reversed) Intergenic
No off target data available for this crispr