ID: 1066609345

View in Genome Browser
Species Human (GRCh38)
Location 10:37222656-37222678
Sequence ATGGAGGAACAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 477}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066609345_1066609349 18 Left 1066609345 10:37222656-37222678 CCTTCCTCATGCTGTTCCTCCAT 0: 1
1: 0
2: 4
3: 52
4: 477
Right 1066609349 10:37222697-37222719 TATCCTCATTCATTCAGACTTGG No data
1066609345_1066609351 21 Left 1066609345 10:37222656-37222678 CCTTCCTCATGCTGTTCCTCCAT 0: 1
1: 0
2: 4
3: 52
4: 477
Right 1066609351 10:37222700-37222722 CCTCATTCATTCAGACTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066609345 Original CRISPR ATGGAGGAACAGCATGAGGA AGG (reversed) Intronic
900433444 1:2613660-2613682 TTGGAGTCAAAGCATGAGGAGGG + Intronic
902104912 1:14026886-14026908 ATGGAGGAACAGCCAGATGGGGG + Intergenic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
902670675 1:17971192-17971214 ATGGATGAACACCATGGTGATGG + Intergenic
904774208 1:32896702-32896724 AGTGAGGAACATCAGGAGGAAGG - Intronic
904912491 1:33945717-33945739 TTGGAGGAAGAGCATTAGGCTGG + Intronic
904991773 1:34598931-34598953 ACAGAGGAACAGCAAGAGGAGGG - Intergenic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907360922 1:53914023-53914045 CTGGAGGTAAAGCATGATGAAGG - Intergenic
907394308 1:54178596-54178618 ATGGAGGGACAGGCTGAGGTGGG + Intronic
907995758 1:59630408-59630430 ATGGAGGAACAGCAAGGACAGGG + Intronic
908370973 1:63477075-63477097 CTGGAGGAGCAGCATGTCGAGGG + Intronic
908385681 1:63639267-63639289 ATGAAGGAAGACCATGAGGGTGG + Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
908721546 1:67131614-67131636 ATGGTGGAACAGAAAGGGGAAGG - Intronic
908893474 1:68872127-68872149 ATGGTGGAACAGTATGAGAGTGG - Intergenic
909103837 1:71384265-71384287 ATGGAGGTAAAGCATGAAGTGGG + Intergenic
910170163 1:84368753-84368775 AGGGAGGCACAGCCAGAGGAAGG + Intronic
911151906 1:94604246-94604268 ATTGATGAGCAGCATGAGCATGG + Intergenic
912821336 1:112870266-112870288 ATGGACAAACAGCATGTGCAGGG - Intergenic
914357827 1:146902967-146902989 ATAGAGGAAAAGCAGGAGGAAGG - Intergenic
915368023 1:155326176-155326198 GTAGAGGAACAGCATAAGCAGGG - Intronic
915645074 1:157264745-157264767 AGAGATGAACAGAATGAGGACGG + Intergenic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
915985547 1:160460678-160460700 GTGGGGGAAGATCATGAGGAAGG + Intergenic
917176070 1:172236923-172236945 ATAGAGGAAGAGGAAGAGGAAGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
920226500 1:204442852-204442874 ATGGCAGAACAGCATGAAGCAGG + Intronic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
1062864951 10:844309-844331 ATCGTGGAACAGCATGGGCATGG + Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063647449 10:7899228-7899250 ATGGAGGGACCGAATGAGAACGG - Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070997734 10:80800743-80800765 ATGGATGACCAGCATAAGGAGGG - Intergenic
1072803325 10:98408125-98408147 AGGCAGGAACAGCATGAGCGGGG - Intronic
1073736778 10:106356990-106357012 ATGGAGGAAAAGTAAAAGGAAGG - Intergenic
1073938084 10:108659003-108659025 TTGGATGAACAGGATGTGGATGG + Intergenic
1074214123 10:111367530-111367552 ATGGAGGCACAGCACAAGGCAGG + Intergenic
1075056470 10:119222596-119222618 AGGGAGGCAGAGCAGGAGGAGGG - Intronic
1076079952 10:127570320-127570342 GTGGAGGATCAGCCTCAGGAGGG + Intergenic
1076161841 10:128250136-128250158 AGGGAGGAAGAGCGAGAGGAAGG - Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084960976 11:72716489-72716511 GTGGAGGAACAGCATCTGGACGG + Intronic
1085036614 11:73304464-73304486 GTGGTGGGACAGCAGGAGGATGG + Intergenic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1087015096 11:93546932-93546954 TGGAAGGAACAGCATGTGGAAGG - Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087686772 11:101274004-101274026 ATGGAGGAAAAGCATGTTCAGGG + Intergenic
1087694184 11:101356836-101356858 AAGGAGGAATAGGATGAGAAGGG - Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1089284196 11:117395211-117395233 ATGGAGGAAGAACAGGAGGGAGG - Intronic
1090072265 11:123554260-123554282 TTGGAGGAATAACTTGAGGAAGG + Intronic
1091180433 11:133599575-133599597 ATGGAGCAAAAGCAGGAGAATGG - Intergenic
1093502818 12:19831916-19831938 AAGGAGGAACAACTAGAGGATGG - Intergenic
1093976486 12:25427522-25427544 ATAGAAGGGCAGCATGAGGAAGG - Intronic
1094285123 12:28783948-28783970 ATGGGGGAAAAGCCTGAAGAGGG + Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095905012 12:47368723-47368745 ATGGAGGAACAGCAAGTGATTGG + Intergenic
1095978138 12:47953898-47953920 ATGCAGGAACGGGATGAGGCAGG - Intergenic
1096212314 12:49776160-49776182 GTGGAGGCACGGCATGGGGAGGG + Intergenic
1096311484 12:50525045-50525067 ATGGAGAAAAAGCATCAAGAGGG + Intronic
1096355505 12:50937885-50937907 ATGGAGGAAGTGCATGCTGATGG + Intergenic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1098143070 12:67470192-67470214 AAGGAGGAAAAGCAAGATGATGG - Intergenic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1101494189 12:105237709-105237731 ATGAAGGAAGAGCATGAGTCTGG - Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101868166 12:108538822-108538844 ATGGAGGAAAAGCAAGAGTAGGG + Intronic
1103245481 12:119453300-119453322 ATGGAAGAAAAGGAGGAGGAGGG - Intronic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1104469466 12:129018075-129018097 ATGGAGGGTCAGCTTGAGGGTGG - Intergenic
1105001990 12:132696006-132696028 GAGGAAGAACAACATGAGGAAGG - Exonic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1107339250 13:39388593-39388615 ATGGGGGAAAATTATGAGGAGGG + Intronic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1111942878 13:94631451-94631473 ATGGGGGAATAGCATTAGGTAGG - Exonic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1113214213 13:108019052-108019074 AGGGAGGTAAAGCAAGAGGAAGG - Intergenic
1113813792 13:113158260-113158282 AGGGAGGGAAAGCAGGAGGATGG - Intergenic
1114626433 14:24132955-24132977 ATGGAGGTCAAGCATAAGGAAGG - Intergenic
1114890983 14:26922749-26922771 AGAAAGGAACAGCATGAGGAAGG + Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116636190 14:47399259-47399281 GAGGAGGAACAGGACGAGGAAGG + Intronic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1118065415 14:62185341-62185363 CTGGAGGGATGGCATGAGGAGGG + Intergenic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119205928 14:72793543-72793565 ATGGAGGTAGAGTGTGAGGATGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1119738542 14:76999357-76999379 CTGGAGGAAGAGGATGAGGGTGG - Intergenic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120147411 14:80994042-80994064 AAGGAGGAAAAGGAAGAGGAGGG - Intronic
1120274504 14:82354486-82354508 TTGGAGGATGAGCTTGAGGATGG - Intergenic
1120356895 14:83445512-83445534 AGGGGAGAACACCATGAGGAAGG - Intergenic
1120472103 14:84938645-84938667 ATTCTGGAACAGCATGAGAAGGG - Intergenic
1120686514 14:87544049-87544071 ATGGAGGAGCTGCCTGAGAAGGG + Intergenic
1120723852 14:87916470-87916492 ATGGAGGTACAGCGGGAGAAAGG + Intronic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1122448919 14:101787913-101787935 ATGAATGAATAGCATGAGAAAGG - Intronic
1124035649 15:26051602-26051624 AAGGAGGGAAAGCAGGAGGAAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125925483 15:43559509-43559531 ATGCATGAACAGGATGGGGATGG + Intronic
1126123286 15:45272441-45272463 TTGGAGGAATAATATGAGGAAGG + Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126560959 15:50043501-50043523 AAGGAGGAAGAGGAAGAGGAGGG - Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127191546 15:56536608-56536630 CTGGAGTAAAGGCATGAGGAAGG + Intergenic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127544425 15:59976991-59977013 ATGCAGGTACAGCAAGAGCAAGG + Intergenic
1127708919 15:61575809-61575831 CTGGAGGAACAGCATGGACAAGG + Intergenic
1128396637 15:67232766-67232788 ATGTAAGAACGGCATGAAGAAGG + Intronic
1128618971 15:69132768-69132790 AGGGAGCCAGAGCATGAGGAAGG + Intergenic
1129117908 15:73375480-73375502 GAGGAGGAAAAGCGTGAGGAGGG + Intergenic
1129179889 15:73867442-73867464 GGGGAGGAAAAGCAGGAGGATGG - Intergenic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1130304829 15:82706344-82706366 ATGGAGGTACAGGATATGGAAGG - Intronic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1130798812 15:87239292-87239314 CTGGGGGCATAGCATGAGGAGGG + Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131901108 15:97088671-97088693 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1131901118 15:97088709-97088731 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132413382 15:101602905-101602927 ATGCAGGAACAGCATGGTGGAGG - Intergenic
1132645976 16:999476-999498 ACGGAGGAACAGCCTGGGGATGG - Intergenic
1132907721 16:2291703-2291725 CTGGAGGAACAGCCTGGGGTGGG - Intronic
1133392405 16:5420937-5420959 GAGGAGGAAAAGCAGGAGGAAGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134686181 16:16160087-16160109 TTAGAGGAACAGCAAGAAGACGG - Intronic
1134870804 16:17650772-17650794 ATGGAACACCAGCATGAGAAAGG + Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135559695 16:23466781-23466803 GTGAAGGAAGAGGATGAGGATGG + Exonic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138633797 16:58320400-58320422 AGAGAGGAAAAGCAAGAGGAGGG + Intronic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139946339 16:70644944-70644966 AAGGAGGAAGAGGAGGAGGAAGG + Intronic
1139976356 16:70814325-70814347 ATAGAGGAAAAGCAGGAGGAAGG + Intronic
1140552937 16:75887167-75887189 AAGGAGCAACAGCCTAAGGAAGG + Intergenic
1140922444 16:79551566-79551588 AGGGAGGCACAGCTTCAGGAAGG - Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141055468 16:80809854-80809876 ATAGAGGAATGGCATGAAGAAGG + Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141334857 16:83145088-83145110 TTGGAGGAGCAGCATATGGATGG - Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141943124 16:87291573-87291595 ATGGAGGTAGACCATGGGGAGGG - Intronic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1143391583 17:6561840-6561862 GTGGAGGAAGAGGAAGAGGATGG - Intergenic
1143983907 17:10894807-10894829 ATGGGGGAAAAGCATGTGAAAGG - Intergenic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144576336 17:16432043-16432065 ATGGAGGGACAGGAGGACGAGGG + Exonic
1144647488 17:16985284-16985306 ATGGTGGAAGAGCAGGAGAATGG - Intergenic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1146234877 17:31149792-31149814 ATGAAGGAGGAGCTTGAGGAGGG + Intronic
1147496297 17:40919328-40919350 ATGTAGCAACAGTATGTGGAGGG - Intergenic
1147666525 17:42152307-42152329 GGGGAGGAACAGCATCAGAAAGG + Intronic
1147727185 17:42573310-42573332 GTGGAGGAAGAGGAAGAGGATGG - Exonic
1148225903 17:45897446-45897468 ATGGAGGAACCTCAGGGGGACGG + Intronic
1148752366 17:49952614-49952636 AAGGAGGTACAGCTAGAGGAAGG - Intergenic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1150836185 17:68566028-68566050 GTGATGGAACAGCATGAGGTGGG - Intronic
1150980168 17:70132524-70132546 CTGGAGGATCACCATGAGCACGG - Exonic
1151355833 17:73558015-73558037 ATAGAGCAACAGGGTGAGGAGGG - Intronic
1151972965 17:77468346-77468368 TTCTAGGAACAGCATGGGGAAGG + Intronic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1154018346 18:10639645-10639667 TTGGAGGAACAGCATAATGGTGG - Intergenic
1154991112 18:21599699-21599721 AGGGAGGAAGAGGAGGAGGAAGG - Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155660846 18:28246605-28246627 CTGGAGCAACAGCATGAACAGGG + Intergenic
1155777283 18:29780885-29780907 TTGGTAGAGCAGCATGAGGAAGG + Intergenic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1156983409 18:43320856-43320878 AGGGAGGAACATCAGGAGGGAGG - Intergenic
1157172991 18:45425204-45425226 ATGGAGGGTCAGCATTTGGATGG - Intronic
1157866776 18:51194873-51194895 GTGGAGGAACAATGTGAGGAGGG - Intronic
1159890043 18:73944216-73944238 AAGAAGGAACAGCATGACAACGG - Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1160555739 18:79723801-79723823 AGGGAGGGACAGCAGGTGGAGGG - Intronic
1160599981 18:80005155-80005177 CTGGGGGAACAGCATGCAGAGGG + Intronic
1160871129 19:1278520-1278542 ATGGAGTCAGAGCATGCGGAGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163712028 19:18852646-18852668 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163712036 19:18852670-18852692 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1164064770 19:21706422-21706444 AGGGATGCACAGGATGAGGAAGG + Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165307997 19:35013818-35013840 ATGGAGGAACAGGACAGGGAGGG + Intronic
1165361939 19:35342091-35342113 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166234516 19:41445976-41445998 ATTCAAGAACAGCATGAGGCCGG + Intergenic
1166674922 19:44734582-44734604 AGGGAGGAAGAGGAAGAGGAAGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167608486 19:50494359-50494381 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1168095179 19:54110314-54110336 GTAGAGGAACAGCACGCGGAAGG - Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
925093315 2:1172824-1172846 GTGGAGGGACAGCATCAGGAAGG - Intronic
925299423 2:2800115-2800137 AGGTAGGAACAGCAGAAGGAGGG + Intergenic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925315799 2:2922188-2922210 CTGGAGGGTCAGCATGAGGCTGG - Intergenic
925837178 2:7957564-7957586 AGAGAGGAAGGGCATGAGGAGGG + Intergenic
925951652 2:8919040-8919062 ATGGAGGAACCTCAAGAGCACGG - Intronic
926744730 2:16141596-16141618 ATGGAGCAAATGCATGAAGATGG - Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
927014386 2:18942471-18942493 ATGGGGGAACAGCCTGTTGATGG + Intergenic
927474511 2:23402140-23402162 ATCGAGGACCGGCAGGAGGAGGG + Intronic
927991273 2:27449042-27449064 GTGGAGGAAAAGCATGAGTGAGG + Intronic
928397216 2:30951938-30951960 AGGGGTGAACAGCCTGAGGAGGG + Intronic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
930851938 2:55970894-55970916 ATGGAGGAACAACTTGGGAATGG - Intergenic
930978431 2:57492904-57492926 ATAGAGGAATAGTGTGAGGAAGG - Intergenic
931249670 2:60518829-60518851 ATCGAGCAACACCATGTGGATGG - Intronic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
935099570 2:99980209-99980231 ATCGAGGAACAGCAGGGGAAAGG - Intronic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
936970895 2:118175297-118175319 ATGGAGGTAGAGGATTAGGAAGG + Intergenic
937065034 2:119011453-119011475 ACTGAGGAACAGCCTGGGGAAGG + Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938143103 2:128812417-128812439 GAGGAGGAAGGGCATGAGGATGG + Intergenic
938212322 2:129478980-129479002 ATGGAGGAAGCGGAGGAGGAAGG - Intergenic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
940049380 2:149446107-149446129 ATGGAAGAATAGCAGGTGGATGG + Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
944930868 2:204517884-204517906 ATGGAGCAAGAGCGTGAGGGCGG - Intergenic
946542544 2:220700790-220700812 AAGCAGGAAGAGCAGGAGGAAGG - Intergenic
946645461 2:221828614-221828636 ATGGAGGAACAGCCGGTGGGTGG + Intergenic
946934784 2:224708817-224708839 AAGGAGGAAAATCAAGAGGAGGG - Intergenic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947667316 2:231914442-231914464 TTGGAGGAACACCATGGGGCGGG - Intergenic
947742806 2:232492583-232492605 ATGGAGGAAGGGCAGGAGGCAGG - Intergenic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
947841413 2:233210151-233210173 ATGGAGGAAGAGCATGAGCTGGG - Intronic
947874496 2:233459350-233459372 AAGGAGGAACGGGATGATGATGG + Intronic
947927932 2:233937983-233938005 CTGCAGGAACAGCCTGTGGACGG - Intronic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
1170614826 20:17940057-17940079 CAGGAGGAACAGCATCAGGTGGG - Intergenic
1170881319 20:20298723-20298745 ATTTGGGAACAGCATGAGGAAGG + Intronic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172564000 20:35914010-35914032 CTGGAAGAACAGGATCAGGAAGG - Intronic
1172635514 20:36407245-36407267 ATGGGGGAACCGCTTGAGGCTGG + Intronic
1172764243 20:37342697-37342719 GTGGAGGGACAGCAGGAGGCAGG + Intergenic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173472074 20:43332041-43332063 CTGGAGGAACTGCATCAGGCGGG + Intergenic
1173896471 20:46554868-46554890 AGGGAGGAGGAGCATGGGGAGGG - Intergenic
1175381783 20:58568755-58568777 AGGGTGGGACTGCATGAGGAGGG - Intergenic
1175382672 20:58574629-58574651 ATGGAGGAAGGGAATGAGGGAGG - Intergenic
1175950616 20:62581351-62581373 ATGCAGGTCCAGCATGAGGTGGG - Intergenic
1176193540 20:63825546-63825568 TTGGAGGAACAGCAAGTGCAGGG - Intronic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179623628 21:42634577-42634599 ATGGAGGAATAGGAGGATGATGG - Intergenic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181462676 22:23094743-23094765 AGGGAGGAAAAGCACCAGGAGGG - Intronic
1181883399 22:25999576-25999598 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1181913778 22:26262719-26262741 AAGGAGGACCAGCATGTGCATGG + Intronic
1181998314 22:26900882-26900904 ATGAAGGAACAAGATGATGATGG + Intergenic
1182072614 22:27474375-27474397 ATGAACGAACAGCAGGAGGGAGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182522471 22:30892183-30892205 TTAGAGGAGGAGCATGAGGAGGG + Intronic
1182704506 22:32268411-32268433 CTGAAGGAACCCCATGAGGAAGG + Intergenic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1183035458 22:35137802-35137824 ATGGAGGAACGGCATGTGTGTGG + Intergenic
1183060643 22:35334518-35334540 ATGGTGGCACACCATGAGGAAGG + Intronic
1184040483 22:41940171-41940193 AAGGAGGAACAGCAAGTGCATGG - Intronic
1184186962 22:42871430-42871452 ATGGAGGACGAGGATGAGCAGGG - Exonic
1184525263 22:45019049-45019071 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1184658146 22:45952438-45952460 ATGGAGGAAGAGCATCTGGATGG + Intronic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
949576814 3:5346135-5346157 AGGGAGGGAGAGCATCAGGAAGG + Intergenic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
950467065 3:13161949-13161971 GTGGGGGAACAGCATGTGCAGGG - Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
951663272 3:25094378-25094400 CTGGAGGAACCCCATGAAGAAGG + Intergenic
951666335 3:25127955-25127977 GTGGAGGAACTTCATTAGGAGGG - Intergenic
952504120 3:33992175-33992197 AAAGAGGAACAACATCAGGAGGG - Intergenic
952557775 3:34552934-34552956 AAGGAGGAAGGGCAGGAGGAGGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953806543 3:46074719-46074741 AAGGAGGAAGAGGAAGAGGAGGG + Intergenic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
956722336 3:72129140-72129162 ATCCAGGAAGAGCAGGAGGATGG + Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
959603267 3:108212956-108212978 AAGGAAGAAGAGCAAGAGGAAGG - Intronic
959659108 3:108845442-108845464 ATGGAGAAAAATCATGAGCAGGG + Intronic
959963832 3:112332291-112332313 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
961712428 3:128837875-128837897 ATGGTGGTACAGCATATGGAAGG + Intergenic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
962855058 3:139337582-139337604 ATTTGGGAACAGCAGGAGGAAGG + Intronic
963793236 3:149605402-149605424 ATGGAGGAAATGTATGAGGCGGG + Intronic
963973932 3:151460086-151460108 AGGAAGGAACAGCAGGATGAAGG + Intergenic
964773660 3:160252479-160252501 AAGGAGGGACAGCTTGAGGCAGG + Intronic
964850207 3:161087957-161087979 ACAGATGAACAACATGAGGAAGG + Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
966295310 3:178413704-178413726 GTGTAGGAAGAGTATGAGGAGGG + Intergenic
967319134 3:188178279-188178301 AAAGAGGAGAAGCATGAGGAGGG - Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
970573488 4:17405264-17405286 AAGGAGGAAGAGGAAGAGGAAGG + Intergenic
970938393 4:21601797-21601819 ATGGAGGAAAAGCTACAGGAAGG - Intronic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
974247093 4:59333852-59333874 ATGGTGGAAGAGCAGAAGGAAGG - Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975504449 4:75122849-75122871 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976553493 4:86423654-86423676 ATATAGGAATAGCATGAGAATGG + Intronic
977280875 4:95038224-95038246 TTTGAGGAACAGGATGAAGAAGG + Intronic
978118109 4:105046891-105046913 ATGGCTGAAGAGCATTAGGATGG - Intergenic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978268543 4:106859006-106859028 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
979779936 4:124637939-124637961 AGCGAGGAAGAGAATGAGGATGG + Intergenic
980418427 4:132524091-132524113 ATGGAGGAACAGAGTGAAGGAGG - Intergenic
980517789 4:133887450-133887472 ATACAGGAACAGCATCAGTAGGG + Intergenic
981412555 4:144449970-144449992 ATGGAAGAACATGATGCGGAAGG + Intergenic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984881386 4:184412737-184412759 AGGGAGGAAGAGAATGACGATGG - Intronic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
986026178 5:3853548-3853570 ATGGAGGGACTGCGTGTGGAGGG - Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
986480219 5:8179424-8179446 ATGGGGGAAGAGCATGGGCATGG - Intergenic
986514548 5:8547515-8547537 ATGGAGGAAGCACATGGGGAAGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989634626 5:43521054-43521076 GAGGAGGAACAGCATGAAGATGG + Intergenic
990829955 5:59944841-59944863 AAGGAGGAAGAGCAGGAAGAGGG - Intronic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
991553735 5:67872097-67872119 TTGGAAGAAGAGCAGGAGGAGGG + Intergenic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
991917360 5:71618360-71618382 ATGGTGGAACAGCAGAAGGTGGG - Intronic
991961705 5:72051201-72051223 AGGGAGGAAGAGCATGGAGAGGG + Intergenic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
992321223 5:75614904-75614926 ATGGAGGAAAAGAATGGTGAGGG + Intronic
992381850 5:76245284-76245306 TTGGAGGAAGAGGAAGAGGAAGG + Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992836531 5:80647318-80647340 AAGAAAGAACAGCATGAAGATGG + Intronic
993407439 5:87529113-87529135 ATGGAAAAAGAGCATGAGAATGG + Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993955575 5:94228475-94228497 ATGGAGGAACAGGAGGTGGGAGG - Intronic
994624299 5:102198645-102198667 ATGGATTGAGAGCATGAGGAAGG + Intergenic
997694647 5:135851539-135851561 ATGGAAGAAGAGCATGAAGCAGG + Intronic
998131797 5:139655192-139655214 ATGGAGGGACAGGCTGAGGGTGG - Intronic
998568362 5:143235864-143235886 ATGGAGGAAGAGCAGCAGCAGGG - Intergenic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
999813081 5:155146581-155146603 ACGAGGGAACAGCATGAGTAGGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000628726 5:163567774-163567796 AGGAAGGAAGAGAATGAGGAAGG - Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000872910 5:166599690-166599712 ATGAAGGAAGATCATGAGCAAGG - Intergenic
1001253352 5:170165374-170165396 AGGGAGGGAGAGCAGGAGGAAGG - Intergenic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1004239593 6:13907984-13908006 AGGGAGGAAGGGAATGAGGAAGG - Intergenic
1004334271 6:14750070-14750092 GAGCAGGAAGAGCATGAGGAAGG - Intergenic
1004526014 6:16408492-16408514 AATGAGGAACATGATGAGGATGG + Intronic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1005365790 6:25075532-25075554 ATGGAGGAATAGCATGTGGGTGG + Intergenic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007853467 6:44829129-44829151 TTGGAGGAACAGGAAAAGGAGGG + Exonic
1008142260 6:47845584-47845606 ATGCAGGAAAATCACGAGGAAGG - Intergenic
1008240491 6:49104072-49104094 ATGGAATAACAACATAAGGAAGG + Intergenic
1008322374 6:50132603-50132625 ATGGAGGAAAAGCATCAGGTAGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008926030 6:56893149-56893171 TGGGAGGAAGAGTATGAGGAGGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009860665 6:69326840-69326862 AGGGAGGATAAGGATGAGGAGGG + Intronic
1010922820 6:81704872-81704894 AGGGAGGAAGAGCAAGAGGGAGG + Intronic
1011668407 6:89658406-89658428 CTGGGGGAACAGCATAAGGTGGG + Intronic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014561633 6:122898337-122898359 CTGGAGGTAAAGCATGAGAAAGG - Intergenic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015112468 6:129609085-129609107 ATGGAGGGAAAGAATGAGGGGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1016277009 6:142365685-142365707 AGGGAGGAAGAGCAGGAGGAGGG + Intronic
1016358601 6:143244334-143244356 GTGGAGGAATAGCAAGAGGTTGG + Intronic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017634557 6:156431145-156431167 GTGGAGGAACAGCAGTAGAAAGG - Intergenic
1017909726 6:158782473-158782495 TTCAAGGAACAGCATGAGGCTGG + Intronic
1018176542 6:161183025-161183047 ATGGGAGAAGAGGATGAGGAAGG + Intronic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1018463230 6:164018784-164018806 ATGGAGGACCTCCATGAGGCTGG - Intergenic
1018582791 6:165322097-165322119 TTGGAGGAGAAGCATTAGGAAGG - Intergenic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019446935 7:1076259-1076281 AGGGAGGAGCACCATGAGGGAGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1022530886 7:31066199-31066221 ATGGAGGATCAGGCTGAGGTGGG + Intronic
1023156115 7:37254117-37254139 ATGCAGGACCAGCAGAAGGAAGG + Intronic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1025073263 7:55920004-55920026 ATGGAGGAACAGCCAGATGGTGG - Intronic
1025910779 7:65826700-65826722 ATAGAGGATCAGCATAATGAGGG - Intergenic
1026869156 7:73840344-73840366 ATGGAGGATCAGCAAGGGAAAGG + Intronic
1027577493 7:79948286-79948308 TTGGAGGACAAGCATGAGTATGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1029471613 7:100758352-100758374 AGGCAGGGACAGCATGGGGAGGG - Intronic
1030640043 7:111994461-111994483 AAGAAGGAACAGCATCAGAAGGG + Intronic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032454366 7:132061682-132061704 ATGGAAGATGAGCATGAGGGTGG + Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1035090236 7:156304441-156304463 ATGAAAGAACAGCATCAAGAAGG + Intergenic
1035094210 7:156340458-156340480 ATGGAGGAAACCCTTGAGGATGG - Intergenic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036768306 8:11562886-11562908 ATGGAAGGACAGCAGGAGCAGGG + Intronic
1037045712 8:14300373-14300395 AGGGAGGAAGGGAATGAGGAAGG + Intronic
1037748179 8:21662847-21662869 AGGGAGGAACAGCCTGGGCAAGG - Intergenic
1038023076 8:23566388-23566410 AGGGAGGAACACCCTGGGGAGGG - Intronic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1038705226 8:29887087-29887109 ATGGAGGCACTGGATGAGTAAGG + Intergenic
1039063734 8:33592133-33592155 GTGGTGGTACAGCATGAGGTAGG + Exonic
1039148290 8:34474768-34474790 ATGCTGGAACAGAATGAGTAAGG + Intergenic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1040071928 8:43195630-43195652 GTGGAGGAAGAGGAGGAGGAGGG + Intronic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1041030062 8:53727817-53727839 ATGGAGGAACAGGATTGGGGTGG - Intronic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041318311 8:56587380-56587402 CTTGAGGAACAGCCTGAAGATGG + Intergenic
1041515998 8:58699665-58699687 ATGAAGGAAGAGCCTGAGGCAGG + Intergenic
1043158258 8:76814032-76814054 ACGGAAGAATAGCATGATGACGG - Intronic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1045281001 8:100749702-100749724 ATGGAGGAAGAGGAGGAGAACGG + Intergenic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1045403597 8:101842999-101843021 ATAGGGGAACACCATGGGGATGG - Intronic
1046808208 8:118503702-118503724 ATGGAGGAAGAGCCCAAGGAGGG - Intronic
1047126326 8:121965200-121965222 ATAGAGGGCTAGCATGAGGAGGG - Intergenic
1047184752 8:122622803-122622825 AAAAAGGAACAGCATGAAGACGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048076323 8:131075172-131075194 ACAGAGGAACAGCATGGGCATGG - Intergenic
1048165633 8:132059178-132059200 ATGGAGGAAAAGAGTGAGGGAGG - Intronic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048625737 8:136183021-136183043 ATGGATGAAAGGCACGAGGAAGG + Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1049515019 8:143049704-143049726 AAGGAGGAGGAGCATAAGGAGGG - Intronic
1049533974 8:143169530-143169552 AGGGAGGAACTGCATGAGCCAGG - Intergenic
1050021030 9:1284733-1284755 ATGGAGGAATGACATGTGGATGG + Intergenic
1051022968 9:12568118-12568140 ACGTAGGAACAGCAAGAGGCTGG - Intergenic
1051320120 9:15894286-15894308 GTGGGGGAAGAGCATCAGGAAGG + Intronic
1051342767 9:16127148-16127170 CTGGAAGAAGAGCATGAAGAGGG - Intergenic
1051657320 9:19395542-19395564 AATGAGGAACAGGAAGAGGATGG - Intergenic
1053202512 9:36162381-36162403 ATGGAAGAACACCAAGAAGATGG + Exonic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055565851 9:77568004-77568026 AGGGAGGAAGAGGAGGAGGAAGG + Intronic
1056937949 9:90932152-90932174 ATTCAGGAACAGAATGAAGAGGG + Intergenic
1058148468 9:101437542-101437564 ATGGAGGAACAAGAGGTGGATGG + Intergenic
1058805792 9:108590378-108590400 ATTGAGCAACAGCATGAAGAAGG - Intergenic
1059772300 9:117438813-117438835 AAATAGGAACAGCATCAGGAAGG + Intergenic
1060876228 9:127085483-127085505 ATGGAAGAAGAGCATGGGGCAGG - Intronic
1062316603 9:135970444-135970466 GAGGAGGGACGGCATGAGGAGGG - Intergenic
1062467100 9:136686327-136686349 ATGTAGCAACAGCCTGGGGACGG + Intronic
1062635817 9:137490726-137490748 ATGAAAGAAGAGCAGGAGGACGG + Intronic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1186079322 X:5912969-5912991 AGGGAGGGAGAGCAGGAGGAAGG + Intronic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186246614 X:7622471-7622493 ATGGAGGGAGAGGAAGAGGAAGG - Intergenic
1186661416 X:11671252-11671274 AGGGAAGAAGAGCATGAGGGAGG + Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1190259809 X:48790773-48790795 GTGGAGGAAGAGCGAGAGGAGGG + Intronic
1190427250 X:50345255-50345277 AGGGAGGAAAAGCAGGAGGAAGG - Intronic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1194940482 X:100003598-100003620 AGGGAGGACCATAATGAGGATGG - Intergenic
1195396809 X:104419715-104419737 TTGGTGGTACAGCATGGGGAGGG + Intergenic
1196562323 X:117164923-117164945 ATGGGGGTACAGCAGGAGGTTGG + Intergenic
1197705312 X:129630473-129630495 ATTGAGGTACAGAATGGGGAGGG + Intergenic
1198067909 X:133118278-133118300 ATGGAGGAATTGCATGAGGAAGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199213917 X:145245671-145245693 ATAGATGAACAGCATGGGCATGG + Intergenic
1199907737 X:152251565-152251587 ATGGAAGAGAAGCAAGAGGAAGG - Intronic
1200754053 Y:6973239-6973261 ATGGGGGAAGATGATGAGGAGGG - Intronic
1201562194 Y:15329960-15329982 ATGAAGGGAGAGCAGGAGGAAGG - Intergenic
1201724548 Y:17138360-17138382 ATGGTGGTACAGCATATGGAAGG + Intergenic