ID: 1066609560

View in Genome Browser
Species Human (GRCh38)
Location 10:37226794-37226816
Sequence ATTTTTCATTAGCAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066609557_1066609560 -7 Left 1066609557 10:37226778-37226800 CCAAAGCAGCTATACCATTTTTC 0: 1
1: 18
2: 104
3: 598
4: 2121
Right 1066609560 10:37226794-37226816 ATTTTTCATTAGCAGTATGAGGG No data
1066609556_1066609560 5 Left 1066609556 10:37226766-37226788 CCAGTACATTTTCCAAAGCAGCT 0: 1
1: 0
2: 4
3: 66
4: 406
Right 1066609560 10:37226794-37226816 ATTTTTCATTAGCAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066609560 Original CRISPR ATTTTTCATTAGCAGTATGA GGG Intronic
No off target data available for this crispr