ID: 1066614631

View in Genome Browser
Species Human (GRCh38)
Location 10:37282539-37282561
Sequence GAGGCTTATCACTAATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066614621_1066614631 26 Left 1066614621 10:37282490-37282512 CCTTTGGAGATTTCTTTGCTTAT 0: 76
1: 112
2: 54
3: 59
4: 363
Right 1066614631 10:37282539-37282561 GAGGCTTATCACTAATAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066614631 Original CRISPR GAGGCTTATCACTAATAGGA AGG Intronic
No off target data available for this crispr