ID: 1066615468

View in Genome Browser
Species Human (GRCh38)
Location 10:37289057-37289079
Sequence CAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2183
Summary {0: 1, 1: 15, 2: 183, 3: 528, 4: 1456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066615468_1066615478 24 Left 1066615468 10:37289057-37289079 CCATCCTGCTTCTGCTCACCCTG 0: 1
1: 15
2: 183
3: 528
4: 1456
Right 1066615478 10:37289104-37289126 TAGTCCCAATGAGATGAACAGGG 0: 3
1: 48
2: 596
3: 1188
4: 1291
1066615468_1066615477 23 Left 1066615468 10:37289057-37289079 CCATCCTGCTTCTGCTCACCCTG 0: 1
1: 15
2: 183
3: 528
4: 1456
Right 1066615477 10:37289103-37289125 CTAGTCCCAATGAGATGAACAGG 0: 5
1: 178
2: 444
3: 388
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066615468 Original CRISPR CAGGGTGAGCAGAAGCAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr