ID: 1066617083

View in Genome Browser
Species Human (GRCh38)
Location 10:37306133-37306155
Sequence AACCCACTGCAGTAAATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066617083_1066617086 1 Left 1066617083 10:37306133-37306155 CCTGTAATTTACTGCAGTGGGTT 0: 1
1: 1
2: 1
3: 10
4: 85
Right 1066617086 10:37306157-37306179 CTAGGCATATAACACCTAAGAGG No data
1066617083_1066617088 30 Left 1066617083 10:37306133-37306155 CCTGTAATTTACTGCAGTGGGTT 0: 1
1: 1
2: 1
3: 10
4: 85
Right 1066617088 10:37306186-37306208 GATTGCCTTAGAATGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066617083 Original CRISPR AACCCACTGCAGTAAATTAC AGG (reversed) Intronic
908916809 1:69137611-69137633 AATTCAATGCTGTAAATTACAGG + Intergenic
910499448 1:87872679-87872701 AACTGACTGCATTAAATTAAAGG + Intergenic
911773476 1:101777506-101777528 AAACCACTGCGGTAGACTACAGG - Intergenic
913209059 1:116568698-116568720 AACCCACTTCATAGAATTACTGG - Intronic
1063066601 10:2616188-2616210 AGGCCACTGCAGTAAATCCCAGG + Intergenic
1066617083 10:37306133-37306155 AACCCACTGCAGTAAATTACAGG - Intronic
1067738780 10:48879816-48879838 CACCCACTGCAGGAAATGAAAGG - Intronic
1069363298 10:67669143-67669165 AGCCCACTGCTGTAATTTAGGGG - Intronic
1071222201 10:83481380-83481402 AACTCACTTCAGTAAATGTCAGG + Intergenic
1072381319 10:94874153-94874175 AGCTCTCTGCAGTAAATTATTGG - Intergenic
1074965215 10:118485005-118485027 AACCCTCTGCAGTACTTCACAGG - Intergenic
1086269863 11:85049549-85049571 AACCTAGTGCAGATAATTACTGG - Intronic
1088679016 11:112222843-112222865 AACCCACTCCAGTGAAATGCAGG + Intronic
1091969932 12:4778674-4778696 AACCCAGAGCAGTAAATTGAAGG - Intronic
1095704621 12:45223147-45223169 AAGCCACTACAGCAAATTAATGG + Intronic
1096365070 12:51022147-51022169 AACACACTGCTGTAAACTTCTGG - Intronic
1096612145 12:52809264-52809286 AACCCACTGCCCTAAAATAAGGG + Intronic
1099844444 12:88011899-88011921 AGCCCACTCCAGTATATTACCGG - Intronic
1100124876 12:91411928-91411950 GACCTACTGCAGTACAGTACAGG - Intergenic
1103748671 12:123143692-123143714 AACCCACTGCATGAAAGTACAGG + Intronic
1105333076 13:19436246-19436268 AACCCACAGCAATAAATTTCAGG - Exonic
1105878630 13:24583540-24583562 AACGCACAGCAGTAAATTTCAGG + Intergenic
1105921219 13:24965520-24965542 AACCCACAGCAGTAAATTTCAGG - Intergenic
1106026272 13:25958584-25958606 AACTCACTGCAGTAAATTACAGG - Intronic
1109991833 13:70068567-70068589 TACCCACTGTATAAAATTACTGG - Intronic
1112612913 13:100974181-100974203 AACACATTGAAGTACATTACAGG - Intergenic
1112657911 13:101472693-101472715 AACCCTCTGCATTAAGTTAATGG - Intronic
1114742187 14:25108851-25108873 AACCCAAAGCAGTGAAGTACTGG + Intergenic
1115953295 14:38746184-38746206 AACCCACTAGAGTAATTTGCTGG - Intergenic
1122184521 14:99980653-99980675 AACCCAGTGCTGCAAATTGCAGG + Intronic
1125031609 15:35081242-35081264 AACCCACAGCAATAAATTTCAGG + Intergenic
1125848421 15:42880871-42880893 AACAGATTGCAGTAGATTACTGG - Intronic
1128485371 15:68080887-68080909 ATCCCACTGCAGTGGTTTACAGG - Intronic
1132275675 15:100561443-100561465 TACCCAATGCAGTAAGTAACTGG + Intronic
1133518351 16:6531815-6531837 TAGACACTGCAGTTAATTACAGG + Intronic
1133668057 16:7989711-7989733 AAACCTCTTCAGAAAATTACTGG + Intergenic
1144213557 17:13035071-13035093 ATGCCACTGCAGGACATTACAGG + Intergenic
1144967145 17:19084420-19084442 AACCAACTGCAGTTAATCCCTGG + Intergenic
1144980775 17:19167647-19167669 AACCAACTGCAGTTAATCCCTGG - Intergenic
1144987447 17:19210586-19210608 AACCAACTGCAGTTAATCCCTGG + Intergenic
1145237474 17:21218771-21218793 AACCCTCTGCAGGCAATAACTGG + Intergenic
1146985643 17:37214490-37214512 AACCCACAGCACAAAACTACGGG + Intronic
1148854298 17:50570298-50570320 AACCCATTGCAGTAACTGCCGGG + Intronic
1150587642 17:66532984-66533006 AACCCACGGCTGGAAAATACTGG + Intronic
1151149296 17:72070019-72070041 ACCCTGCTGCTGTAAATTACAGG + Intergenic
1157039859 18:44025429-44025451 AACCCACTTAAGAGAATTACTGG + Intergenic
1159408590 18:68039314-68039336 AACCAACTGCAATAATTTAATGG + Intergenic
931359163 2:61563681-61563703 ATCCCACTGCAGTCAAGTATCGG + Intergenic
937488533 2:122341327-122341349 AACCCACTACATCCAATTACTGG + Intergenic
941715248 2:168756608-168756630 AACACATTGCAGGGAATTACAGG + Intronic
941788419 2:169523705-169523727 GAACCACTGTAGTAGATTACAGG - Intronic
944927865 2:204483781-204483803 AAGCCACTGCCGTATATTACAGG + Intergenic
947335583 2:229079634-229079656 AACCCACTTCTTGAAATTACAGG - Intronic
947780588 2:232757607-232757629 AACCCACAGCAGAAAAACACAGG - Intronic
1169736509 20:8843458-8843480 ATACCACTGCATCAAATTACTGG - Intronic
1175326442 20:58132013-58132035 TCCCCACTGCAGTCAATTGCGGG + Intergenic
1182099220 22:27646090-27646112 AGCCCTCTGGAGTAATTTACGGG - Intergenic
1184967182 22:47987992-47988014 CACTCACTGCAGTAAACAACAGG - Intergenic
952037983 3:29226556-29226578 ACCCCTCTGCAGTAACTTAAGGG + Intergenic
953567951 3:44049233-44049255 ACCCCACAGCAGCAAATTCCAGG + Intergenic
955536343 3:59927795-59927817 AACCCACTGCAGTTAAGTTTTGG - Intronic
955600839 3:60643246-60643268 CCCCCACAGCATTAAATTACTGG + Intronic
958692080 3:97481383-97481405 AACCCACAGCAAAAAATTTCAGG - Intronic
962621189 3:137181397-137181419 AATCCACTGAAGAATATTACAGG - Intergenic
965437892 3:168675033-168675055 AACTCACTGCAGGGAATTAGGGG + Intergenic
965921185 3:173916007-173916029 AACCCACTGCAGTAAAGGCAAGG - Intronic
967237900 3:187405538-187405560 CACCTACTGCAGGAAGTTACAGG - Intergenic
968850838 4:3076588-3076610 AAAGCACTACAGTAAATTTCTGG - Intronic
975445208 4:74456100-74456122 AATGCAGTGCAGTAAATAACTGG + Intergenic
977188043 4:93965167-93965189 AAACCACTGTACTAACTTACTGG + Intergenic
977913314 4:102562444-102562466 CACACACTGCAGTAAACTAGGGG - Intronic
978766755 4:112412451-112412473 AACCCACTGAAGTAATTTGAGGG + Intronic
980013783 4:127624498-127624520 AACCAACTGCAGAAAATTGCAGG - Intronic
981021810 4:140037116-140037138 AACACAGTTCAGTAGATTACTGG + Intronic
991764799 5:69963442-69963464 AACCAACTGCAGGTAATTGCAGG - Intergenic
991782525 5:70154711-70154733 AACCAACTGCAGGTAATTGCAGG + Intergenic
991844031 5:70838513-70838535 AACCAACTGCAGGTAATTGCAGG - Intergenic
991874968 5:71155024-71155046 AACCAACTGCAGGTAATTGCAGG + Intergenic
998537682 5:142949811-142949833 AACCCTCTGCAGTGACATACAGG + Intronic
1002444454 5:179280566-179280588 AACCCACTCCTGTAAAATAAAGG + Intronic
1005222174 6:23599186-23599208 ATCCCACTGCAGTTAACCACTGG + Intergenic
1008274480 6:49526916-49526938 AAACCACTGCAGTTTTTTACTGG - Exonic
1009405181 6:63303794-63303816 CTCACACTGCAGTAAAATACTGG + Intronic
1010182392 6:73102695-73102717 ATCTCACTCCAGTAAATGACAGG + Intronic
1014033235 6:116733944-116733966 AACCTACAGCTGTAAAATACAGG + Exonic
1018287431 6:162255879-162255901 AATCCACTGAAGTAAATTATCGG + Intronic
1018889854 6:167976112-167976134 AAACCACTGCATTAAAATATGGG + Intergenic
1019682553 7:2359606-2359628 AAGCTGCTGCAGTAAATTAATGG + Intronic
1020366287 7:7384206-7384228 AACCCAGTGCAGTAACATACTGG + Intronic
1031043709 7:116863753-116863775 AAGCCAGTGCAGGAAAATACAGG + Intronic
1040660044 8:49562126-49562148 ATTCCAATGCAGTAAATTATTGG - Intergenic
1045167521 8:99623501-99623523 TACCCAGTGCCTTAAATTACTGG + Intronic
1058070170 9:100593792-100593814 AAGCCACAGGAGTAAATCACAGG - Intergenic
1061218141 9:129233739-129233761 AACTCACTGCTGTAAAATAAGGG + Intergenic
1187193801 X:17061445-17061467 ATCCTTCTGCAGTAAAGTACTGG - Intronic
1188330225 X:28861556-28861578 AGTCCACTGCAGTTCATTACAGG - Intronic
1192780572 X:74290557-74290579 AAACTACTGCAGTAAATGACTGG + Intergenic
1193734327 X:85138583-85138605 AAACCACTGGAGTCAATAACTGG - Intergenic