ID: 1066625684

View in Genome Browser
Species Human (GRCh38)
Location 10:37403024-37403046
Sequence AGGGCTATTCTGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066625676_1066625684 17 Left 1066625676 10:37402984-37403006 CCCTGCAACAGAGGGGTCAGAAA No data
Right 1066625684 10:37403024-37403046 AGGGCTATTCTGAATGAGGAAGG No data
1066625677_1066625684 16 Left 1066625677 10:37402985-37403007 CCTGCAACAGAGGGGTCAGAAAA No data
Right 1066625684 10:37403024-37403046 AGGGCTATTCTGAATGAGGAAGG No data
1066625675_1066625684 18 Left 1066625675 10:37402983-37403005 CCCCTGCAACAGAGGGGTCAGAA No data
Right 1066625684 10:37403024-37403046 AGGGCTATTCTGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066625684 Original CRISPR AGGGCTATTCTGAATGAGGA AGG Intergenic
No off target data available for this crispr