ID: 1066626561

View in Genome Browser
Species Human (GRCh38)
Location 10:37412935-37412957
Sequence TGCTAATGAAGTTTTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066626558_1066626561 -5 Left 1066626558 10:37412917-37412939 CCGAGGCAAAATTAAAATTGCTA 0: 29
1: 155
2: 212
3: 193
4: 428
Right 1066626561 10:37412935-37412957 TGCTAATGAAGTTTTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066626561 Original CRISPR TGCTAATGAAGTTTTGGGCA TGG Intergenic
No off target data available for this crispr