ID: 1066636838

View in Genome Browser
Species Human (GRCh38)
Location 10:37511625-37511647
Sequence CTGTAGGAGCAGTGTCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066636832_1066636838 29 Left 1066636832 10:37511573-37511595 CCTAGTTTTCAGAAGACATATGT No data
Right 1066636838 10:37511625-37511647 CTGTAGGAGCAGTGTCCCAATGG No data
1066636836_1066636838 -7 Left 1066636836 10:37511609-37511631 CCAAGGCAGAAGTTTGCTGTAGG 0: 48
1: 390
2: 651
3: 507
4: 511
Right 1066636838 10:37511625-37511647 CTGTAGGAGCAGTGTCCCAATGG No data
1066636835_1066636838 1 Left 1066636835 10:37511601-37511623 CCTGGATGCCAAGGCAGAAGTTT No data
Right 1066636838 10:37511625-37511647 CTGTAGGAGCAGTGTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066636838 Original CRISPR CTGTAGGAGCAGTGTCCCAA TGG Intergenic
No off target data available for this crispr