ID: 1066645074

View in Genome Browser
Species Human (GRCh38)
Location 10:37598408-37598430
Sequence CAAATCAACTCCAAAGCTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066645074_1066645080 18 Left 1066645074 10:37598408-37598430 CCGCTAGCTTTGGAGTTGATTTG No data
Right 1066645080 10:37598449-37598471 CTCTAAATGTGATGTTAGGGGGG No data
1066645074_1066645075 14 Left 1066645074 10:37598408-37598430 CCGCTAGCTTTGGAGTTGATTTG No data
Right 1066645075 10:37598445-37598467 GTTCCTCTAAATGTGATGTTAGG No data
1066645074_1066645079 17 Left 1066645074 10:37598408-37598430 CCGCTAGCTTTGGAGTTGATTTG No data
Right 1066645079 10:37598448-37598470 CCTCTAAATGTGATGTTAGGGGG No data
1066645074_1066645077 16 Left 1066645074 10:37598408-37598430 CCGCTAGCTTTGGAGTTGATTTG No data
Right 1066645077 10:37598447-37598469 TCCTCTAAATGTGATGTTAGGGG No data
1066645074_1066645081 30 Left 1066645074 10:37598408-37598430 CCGCTAGCTTTGGAGTTGATTTG No data
Right 1066645081 10:37598461-37598483 TGTTAGGGGGGCATGTGACCAGG No data
1066645074_1066645076 15 Left 1066645074 10:37598408-37598430 CCGCTAGCTTTGGAGTTGATTTG No data
Right 1066645076 10:37598446-37598468 TTCCTCTAAATGTGATGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066645074 Original CRISPR CAAATCAACTCCAAAGCTAG CGG (reversed) Intergenic
No off target data available for this crispr