ID: 1066645081

View in Genome Browser
Species Human (GRCh38)
Location 10:37598461-37598483
Sequence TGTTAGGGGGGCATGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066645078_1066645081 -10 Left 1066645078 10:37598448-37598470 CCTCTAAATGTGATGTTAGGGGG No data
Right 1066645081 10:37598461-37598483 TGTTAGGGGGGCATGTGACCAGG No data
1066645074_1066645081 30 Left 1066645074 10:37598408-37598430 CCGCTAGCTTTGGAGTTGATTTG No data
Right 1066645081 10:37598461-37598483 TGTTAGGGGGGCATGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066645081 Original CRISPR TGTTAGGGGGGCATGTGACC AGG Intergenic
No off target data available for this crispr