ID: 1066652866

View in Genome Browser
Species Human (GRCh38)
Location 10:37675496-37675518
Sequence GATTCATGGTTGGCTGGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066652866_1066652870 -5 Left 1066652866 10:37675496-37675518 CCGGTTCCAGCCAACCATGAATC No data
Right 1066652870 10:37675514-37675536 GAATCTACTTTTTGTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066652866 Original CRISPR GATTCATGGTTGGCTGGAAC CGG (reversed) Intergenic
No off target data available for this crispr