ID: 1066654472

View in Genome Browser
Species Human (GRCh38)
Location 10:37685671-37685693
Sequence CCTGTAGGGTACCCAAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066654472_1066654478 12 Left 1066654472 10:37685671-37685693 CCGGACTTTGGGTACCCTACAGG No data
Right 1066654478 10:37685706-37685728 TGGTCCCCAGCAGAATCTCCTGG No data
1066654472_1066654479 13 Left 1066654472 10:37685671-37685693 CCGGACTTTGGGTACCCTACAGG No data
Right 1066654479 10:37685707-37685729 GGTCCCCAGCAGAATCTCCTGGG No data
1066654472_1066654477 -8 Left 1066654472 10:37685671-37685693 CCGGACTTTGGGTACCCTACAGG No data
Right 1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066654472 Original CRISPR CCTGTAGGGTACCCAAAGTC CGG (reversed) Intergenic