ID: 1066655991

View in Genome Browser
Species Human (GRCh38)
Location 10:37700595-37700617
Sequence AGGGTGGGACTCAGCTGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066655991_1066655999 18 Left 1066655991 10:37700595-37700617 CCTTCGCAGCTGAGTCCCACCCT No data
Right 1066655999 10:37700636-37700658 TTCATGCAATAAATGCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066655991 Original CRISPR AGGGTGGGACTCAGCTGCGA AGG (reversed) Intergenic