ID: 1066656921

View in Genome Browser
Species Human (GRCh38)
Location 10:37705078-37705100
Sequence AGCCAGCCAAGCCCTACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066656921_1066656925 2 Left 1066656921 10:37705078-37705100 CCTTGTGTAGGGCTTGGCTGGCT No data
Right 1066656925 10:37705103-37705125 CTGCATGTCTTGTGGCTGGTGGG No data
1066656921_1066656928 24 Left 1066656921 10:37705078-37705100 CCTTGTGTAGGGCTTGGCTGGCT No data
Right 1066656928 10:37705125-37705147 GACAGACATGAGCAGGGACATGG No data
1066656921_1066656922 -6 Left 1066656921 10:37705078-37705100 CCTTGTGTAGGGCTTGGCTGGCT No data
Right 1066656922 10:37705095-37705117 CTGGCTGACTGCATGTCTTGTGG No data
1066656921_1066656926 17 Left 1066656921 10:37705078-37705100 CCTTGTGTAGGGCTTGGCTGGCT No data
Right 1066656926 10:37705118-37705140 CTGGTGGGACAGACATGAGCAGG No data
1066656921_1066656924 1 Left 1066656921 10:37705078-37705100 CCTTGTGTAGGGCTTGGCTGGCT No data
Right 1066656924 10:37705102-37705124 ACTGCATGTCTTGTGGCTGGTGG No data
1066656921_1066656923 -2 Left 1066656921 10:37705078-37705100 CCTTGTGTAGGGCTTGGCTGGCT No data
Right 1066656923 10:37705099-37705121 CTGACTGCATGTCTTGTGGCTGG No data
1066656921_1066656927 18 Left 1066656921 10:37705078-37705100 CCTTGTGTAGGGCTTGGCTGGCT No data
Right 1066656927 10:37705119-37705141 TGGTGGGACAGACATGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066656921 Original CRISPR AGCCAGCCAAGCCCTACACA AGG (reversed) Intergenic
No off target data available for this crispr