ID: 1066659899

View in Genome Browser
Species Human (GRCh38)
Location 10:37728641-37728663
Sequence GGCTGCACACCTTGGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066659899_1066659913 8 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659913 10:37728672-37728694 CCCGGGGGTTCCTGTCTAGCTGG No data
1066659899_1066659908 -7 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659908 10:37728657-37728679 TGCAGCCCCAGTGGGCCCGGGGG No data
1066659899_1066659915 14 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659915 10:37728678-37728700 GGTTCCTGTCTAGCTGGACCTGG No data
1066659899_1066659906 -9 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659906 10:37728655-37728677 TGTGCAGCCCCAGTGGGCCCGGG No data
1066659899_1066659917 19 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659917 10:37728683-37728705 CTGTCTAGCTGGACCTGGCCAGG No data
1066659899_1066659907 -8 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659907 10:37728656-37728678 GTGCAGCCCCAGTGGGCCCGGGG No data
1066659899_1066659918 25 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659918 10:37728689-37728711 AGCTGGACCTGGCCAGGACTCGG No data
1066659899_1066659905 -10 Left 1066659899 10:37728641-37728663 CCTGTTCCCCAAGGTGTGCAGCC No data
Right 1066659905 10:37728654-37728676 GTGTGCAGCCCCAGTGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066659899 Original CRISPR GGCTGCACACCTTGGGGAAC AGG (reversed) Intergenic
No off target data available for this crispr