ID: 1066662252

View in Genome Browser
Species Human (GRCh38)
Location 10:37748095-37748117
Sequence GCTGAGGGTGAGGCACGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066662252_1066662263 30 Left 1066662252 10:37748095-37748117 CCTAGTCGTGCCTCACCCTCAGC No data
Right 1066662263 10:37748148-37748170 GTGGACAATGCCCTTTTGCGTGG No data
1066662252_1066662256 0 Left 1066662252 10:37748095-37748117 CCTAGTCGTGCCTCACCCTCAGC No data
Right 1066662256 10:37748118-37748140 ACCCCCACATCCTCTGTGTATGG No data
1066662252_1066662262 11 Left 1066662252 10:37748095-37748117 CCTAGTCGTGCCTCACCCTCAGC No data
Right 1066662262 10:37748129-37748151 CTCTGTGTATGGTGAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066662252 Original CRISPR GCTGAGGGTGAGGCACGACT AGG (reversed) Intergenic
No off target data available for this crispr