ID: 1066663425 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:37759028-37759050 |
Sequence | AAGGATCAGATGGACTCCCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1066663423_1066663425 | -10 | Left | 1066663423 | 10:37759015-37759037 | CCACTAGGCAAGGAAGGATCAGA | No data | ||
Right | 1066663425 | 10:37759028-37759050 | AAGGATCAGATGGACTCCCTTGG | No data | ||||
1066663419_1066663425 | 6 | Left | 1066663419 | 10:37758999-37759021 | CCTGTGCTAAAGGAGACCACTAG | No data | ||
Right | 1066663425 | 10:37759028-37759050 | AAGGATCAGATGGACTCCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1066663425 | Original CRISPR | AAGGATCAGATGGACTCCCT TGG | Intergenic | ||
No off target data available for this crispr |