ID: 1066663425

View in Genome Browser
Species Human (GRCh38)
Location 10:37759028-37759050
Sequence AAGGATCAGATGGACTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066663423_1066663425 -10 Left 1066663423 10:37759015-37759037 CCACTAGGCAAGGAAGGATCAGA No data
Right 1066663425 10:37759028-37759050 AAGGATCAGATGGACTCCCTTGG No data
1066663419_1066663425 6 Left 1066663419 10:37758999-37759021 CCTGTGCTAAAGGAGACCACTAG No data
Right 1066663425 10:37759028-37759050 AAGGATCAGATGGACTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066663425 Original CRISPR AAGGATCAGATGGACTCCCT TGG Intergenic
No off target data available for this crispr